View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_high_106 (Length: 229)
Name: NF15745_high_106
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_high_106 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 16 - 201
Target Start/End: Complemental strand, 7544216 - 7544031
Alignment:
| Q |
16 |
atgaataatatgtggttaacgttattgatacgagtaattttttctagaactaagagaaaaaatgcactattgacttggtcattggtgattattttgttcc |
115 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7544216 |
atgaataatatgtggttaacgttattgttacgagtaattttttctagaactaagagaaaaaatgcactattgacttggtcattggtgattattttgtttc |
7544117 |
T |
|
| Q |
116 |
tagggtgtttccttgtgaagcacattaaagagttgaaatttactttggtcgtcatctctagatgatatactaatttctagatagtg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7544116 |
tagggtgtttccttgtgaagcacattaaagagttgaaatttactttggtcgtcatctctagatgatatactaatttctagatagtg |
7544031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 83 - 137
Target Start/End: Complemental strand, 7553909 - 7553855
Alignment:
| Q |
83 |
tattgacttggtcattggtgattattttgttcctagggtgtttccttgtgaagca |
137 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||| | ||||||||| |||||| |
|
|
| T |
7553909 |
tattgaattggtcattggtgattattttgtttctaagaggtttccttgagaagca |
7553855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University