View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_high_112 (Length: 219)
Name: NF15745_high_112
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_high_112 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 207
Target Start/End: Complemental strand, 21531840 - 21531650
Alignment:
| Q |
17 |
attaccttggtatgtaggtaatgaacgccaaataatggcttctccgctcctacgacgacggtgtaagaatgcgttgaatatgtgaagtttttagcgtata |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21531840 |
attaccttggtatgtaggtaatgaacgccaagtaatggcttctctgctcctaggacgacggtgtaagaatgcgttgaatatgtgaagtttttagcgtata |
21531741 |
T |
|
| Q |
117 |
tgtatagagttgttagttagtcgttatacgtatatgtgagtagattagagtgaggacaacatatcatctaaaatagatggtttatattcat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
21531740 |
tgtatagagttgttagttagtcgttatacgtatatgtgagtagattagagtgaggacaacatatcatccaaaatagacggtttagattcat |
21531650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University