View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_high_116 (Length: 212)
Name: NF15745_high_116
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_high_116 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 7159391 - 7159589
Alignment:
| Q |
1 |
cactcaagggcattcatcttagtccttaggcgacaaagaaaataatccttttagccaagggactgcaatatacaataatactatccgacccattcctact |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7159391 |
cactcaagggcattcatctcagtccttaggtgacaaagaaaataatccttttagccaagggactgcaatatacaataatactatccaacccattcctact |
7159490 |
T |
 |
| Q |
101 |
atgtcgatgtaccagcagctatgggctcaccaaactcagtagtgaggacgggctgttaagctcgccagtgcagaagcaggttatttacatgatgattgt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7159491 |
atgtcgatgtaccagcagctatgggctcaccaaactcagtagtgaggacgggctgttaagctcgccagtgcagaagcaggttatttacatgatgattgt |
7159589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 4867536 - 4867731
Alignment:
| Q |
1 |
cactcaagggcattcatcttagtccttaggcgacaaagaaaataatccttttagccaagggactgcaatatacaataatactatccgacccattcctact |
100 |
Q |
| |
|
|||||| |||| ||||||| |||||||||| | ||| || ||||||| |||| ||||| || ||| ||| |||||||| | ||||| |||||||||||| |
|
|
| T |
4867536 |
cactcacgggccttcatctgagtccttaggtgtcaatgagaataatcttttttgccaacggcctgaaatctacaataagattatccaacccattcctacc |
4867635 |
T |
 |
| Q |
101 |
atgtcgatgtaccagcagctatgggctcaccaaactcagtagtgaggacgggctgttaagctcgccagtgcagaagcaggttatttacatgatgat |
196 |
Q |
| |
|
||||||||||||||||| | || |||||||||||||| ||||||||| |||| |||||||| ||| || ||||||| ||||||||||||||||| |
|
|
| T |
4867636 |
atgtcgatgtaccagcaaccataagctcaccaaactcaacagtgaggacaggcttttaagctcaccaatgtagaagcaagttatttacatgatgat |
4867731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University