View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_high_117 (Length: 212)
Name: NF15745_high_117
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_high_117 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 12 - 212
Target Start/End: Complemental strand, 51901665 - 51901462
Alignment:
| Q |
12 |
atgaataacaaaatcacacggggaagtaacaagtcacatgcttcatcctccatcaaaagggaaaccccaaaaataagcaatctatagagcagttatgaag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51901665 |
atgaataacaaaatcacacggggaagtaacaagtcacatgcttcatcctccatcaaaagggaaaccccaaaaataagcaatctatagagcagttatgaag |
51901566 |
T |
 |
| Q |
112 |
ttattgggcttgcccctttgcc---acaatgcgtttattgaccattgtggtcaatcaatgtgggtcatagaaaatcacggaaaataatactcatgatggt |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
51901565 |
ttattgggcttgcccctttgccacaacaatgcgtttattgaccattgtggtcaatcaatgtgggtcatcgaaaatcacggaaaataatactcatgatggt |
51901466 |
T |
 |
| Q |
209 |
tgcc |
212 |
Q |
| |
|
|||| |
|
|
| T |
51901465 |
tgcc |
51901462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University