View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_high_47 (Length: 363)
Name: NF15745_high_47
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_high_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 8e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 115 - 279
Target Start/End: Complemental strand, 48316989 - 48316825
Alignment:
| Q |
115 |
gcagtgatgtttctaataatgacctttgtggaacaataccagtagatggcaactttggatccttcccaataaaaaggtacaacaactttgcctttgaatg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48316989 |
gcagtgatgtttctaataatgacctttgtggaacaataccagtagatggcaactttggatccttcccaataaaaaggtacaacaactttgcctttgaatg |
48316890 |
T |
|
| Q |
215 |
cataacaaatgtactcgtatgatgacacaaatattcatatatattgaaactatagcaatttaaat |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48316889 |
cataacaaatgtactcgtatgatgacacaaatattcataaatattgaaactatagcaatttaaat |
48316825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 306 - 349
Target Start/End: Complemental strand, 48316823 - 48316781
Alignment:
| Q |
306 |
caaattgtccttttccttttttcagttttgaaaataacagactc |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48316823 |
caaattgtccttttccttttt-cagttttgaaaataacagactc |
48316781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 115 - 182
Target Start/End: Original strand, 251336 - 251403
Alignment:
| Q |
115 |
gcagtgatgtttctaataatgacctttgtggaacaataccagtagatggcaactttggatccttccca |
182 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
251336 |
gcagtgatgtttccaataatgacctctgtggaacaataccagtagatggcaactttggatctttccca |
251403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University