View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_high_59 (Length: 316)
Name: NF15745_high_59
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_high_59 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 28 - 230
Target Start/End: Complemental strand, 52161614 - 52161412
Alignment:
| Q |
28 |
atgaatctctttccattgatccatcactttccctcaccggcaatggagcttcttcatcaattgttcgagctgcttttgatagatatagagggatagtgtt |
127 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52161614 |
atgattctctttccattgatccatcactttccctcaccggcaatggtgcttcttcatcaattgttcgagctgcttttgatagatatagagggatagtgtt |
52161515 |
T |
|
| Q |
128 |
caagaacagttacagctttggttttcttagaacaggaaaagttgcttatgatgttacaaaattgaatattgttgttcattccaaaaatgaagaggtgggt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52161514 |
caagaacagttacagctttggttttcttagaacaggaaaagttgcttatgatgttacaaaattgaatattgttgttcattccaaaaatgaagaggtgggt |
52161415 |
T |
|
| Q |
228 |
tac |
230 |
Q |
| |
|
||| |
|
|
| T |
52161414 |
tac |
52161412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 172 - 230
Target Start/End: Complemental strand, 3226669 - 3226611
Alignment:
| Q |
172 |
cttatgatgttacaaaattgaatattgttgttcattccaaaaatgaagaggtgggttac |
230 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||| |||||||||| ||||| |
|
|
| T |
3226669 |
cttatgatgttacaaaattgaatatttttgttcattctaaaagtgaagaggtgagttac |
3226611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University