View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_high_70 (Length: 283)
Name: NF15745_high_70
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_high_70 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 2 - 272
Target Start/End: Original strand, 154523 - 154793
Alignment:
| Q |
2 |
ctggtgatgattatctcgtttgtaacctcctgtattcgatttgggcttccattgctatcaaagtgtgtgccatgtccaggggagtgtcccagctccccaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
154523 |
ctggtgatgattatctcgtttgtaacctcctgtattcgatttgggcttccattgctatcaaagtgtgtgccatgtccaggggagtgtcccagctccccaa |
154622 |
T |
 |
| Q |
102 |
ccggaggcttctcaatacactacgacaattttcagtgtccaccaaaccactacaatgatctcagctctctatttttcactaccaacgacgatgccatccg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
154623 |
ccggaggcttctcaatacactacgacaattttcagtgtccaccaaaccactacaatgatctcagctctctatttttcactaccaacgacgatgccatccg |
154722 |
T |
 |
| Q |
202 |
cagcctattcaatgatggctccgcctctgctaacaccggatttcagctatcaagtctcataattttcttcg |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
154723 |
cagcctattcaatgatggctccgcctctgctaacaccggatttcagctatcaagtctcataattttcttcg |
154793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University