View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_high_76 (Length: 262)
Name: NF15745_high_76
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_high_76 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 249
Target Start/End: Complemental strand, 42317809 - 42317577
Alignment:
| Q |
17 |
tgacttgaacttgacggttgnnnnnnntttgacgatggattaccatcttcaatcgtaacacataactcgatcgataaaattgcatcatacttcttataaa |
116 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42317809 |
tgacttgaacttgacggttgaaaaaaatttgatgatggattaccatcttcaatcgtaacacataactcgatcgataaaattacatcatacttcttataaa |
42317710 |
T |
 |
| Q |
117 |
tgtcaaacataaactcaacatcgtcgttatccgtaattttataggattcatatagaatattgctctttccaataaacatagggattctacaaataatctc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42317709 |
tgtcaaacataaactcaacatcgtcgttatctgtaattttataggattcatatagaatattgctctttccaataaacatagggattctacaaataatctc |
42317610 |
T |
 |
| Q |
217 |
agatacaaccttattgtttcctaacttgaattt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42317609 |
agatacaaccttattgtttcctaacttgaattt |
42317577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University