View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_high_77 (Length: 258)
Name: NF15745_high_77
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_high_77 |
 | |
|
| [»] scaffold0202 (1 HSPs) |
| | |
|
| [»] scaffold0018 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 6e-52; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 85 - 212
Target Start/End: Complemental strand, 31094164 - 31094037
Alignment:
| Q |
85 |
ctgaatttattgttaccaatattagttgcatttaggtattatcatcattgttacatttagataacaaacttgtggagttgtttgaaatgttcaaattcaa |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31094164 |
ctgaatttattgttaccaatattagttgcatttagatattaacatcattgttacatttagataacaaacttgtggagttgtttgaaatgttcaaattcaa |
31094065 |
T |
|
| Q |
185 |
ttcagattgttgcaaacaattgcctcaa |
212 |
Q |
| |
|
||||||| ||||||||| |||||||| |
|
|
| T |
31094064 |
ttcagatatttgcaaacacatgcctcaa |
31094037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 31051191 - 31051294
Alignment:
| Q |
138 |
catttagataacaaacttgtggagttgtttgaaatgttcaaattcaattcagattgttgcaaacaattgcctcaagaaaacaaacatggaagcaatagta |
237 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
31051191 |
catttagataacaaacttgtggagttatttgaaatgttcaaattcaattcagattgttgcaaacaaatgcctcaa-aagacaaacatggaagcaatagta |
31051289 |
T |
|
| Q |
238 |
gtaag |
242 |
Q |
| |
|
||||| |
|
|
| T |
31051290 |
gtaag |
31051294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 85 - 119
Target Start/End: Original strand, 31051163 - 31051197
Alignment:
| Q |
85 |
ctgaatttattgttaccaatattagttgcatttag |
119 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
31051163 |
ctgaatttattgttacaaatattagttgcatttag |
31051197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0202 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: scaffold0202
Description:
Target: scaffold0202; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 85 - 237
Target Start/End: Complemental strand, 2867 - 2709
Alignment:
| Q |
85 |
ctgaatttattgttaccaatattagttgcatttaggtattatcatcattgttacattta------gataacaaacttgtggagttgtttgaaatgttcaa |
178 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||| || ||||||||||| |
|
|
| T |
2867 |
ctgaatttattgttaccgacattagttgcatttagatattaacatcattgttacatttacatttagataacaaacttgtggagttcttcgaaatgttcaa |
2768 |
T |
|
| Q |
179 |
attcaattcagattgttgcaaacaattgcctcaagaaaacaaacatggaagcaatagta |
237 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
2767 |
attcaattcagattgttgcaagcacatgcctcaagaagacaaacatggaagtaatagta |
2709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 121 - 191
Target Start/End: Complemental strand, 173460 - 173390
Alignment:
| Q |
121 |
tattatcatcattgttacatttagataacaaacttgtggagttgtttgaaatgttcaaattcaattcagat |
191 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
173460 |
tattaacatcattgttacattcagataacaaacttgtcgagttatttgaaatgttcaaattcaattcagat |
173390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University