View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_low_109 (Length: 246)
Name: NF15745_low_109
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_low_109 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 54 - 180
Target Start/End: Complemental strand, 52954644 - 52954518
Alignment:
| Q |
54 |
ctccttcaccgagttgaaaattgggaatggatcctctctannnnnnnnctctcttgcgttttctcaagtttcacatctcaacttttaaccaatatctact |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52954644 |
ctccttcaccgagttgaaaattgggaatggatcctctctattttttttttctcttgcgttttctcaagtttcacatctcaacttttaaccaatatctact |
52954545 |
T |
 |
| Q |
154 |
tcnnnnnnnncttttcaaaattatccc |
180 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
52954544 |
tcttttttttcttttcaaaattatccc |
52954518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 14 - 60
Target Start/End: Complemental strand, 52954703 - 52954657
Alignment:
| Q |
14 |
aaacactcatcagacacggccgtgaatggatttggatcatctccttc |
60 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52954703 |
aaacactcatcagacgcggccgtgaatggatttggatcatctccttc |
52954657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University