View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_low_116 (Length: 237)
Name: NF15745_low_116
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_low_116 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 41866417 - 41866644
Alignment:
| Q |
1 |
ttgttgatcttggcgagcaaaagccatgaaaacaaagttgttgcgataggcaaatgtgacctttgatcagaaagatg-------atatannnnnnncact |
93 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |||| |
|
|
| T |
41866417 |
ttgttgatcttggcgagcaaaaaccatgaaaacaaagttgttgcgataggcaagtgtgacctttgatcagaaagatgtactttgatatatttttttcact |
41866516 |
T |
|
| Q |
94 |
tcatttgtgggcatttgaattgaattcatggagggtttctgttctttagagggaaaattgtaatgagagagaaggaagattgaaaattgaaggaaggtaa |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41866517 |
tcatttgtgggcatttgaattgaattcatggagggtttctgttctttagagggaaaattgtaatgagagagaaggaagattgaaaattgaaggaagttag |
41866616 |
T |
|
| Q |
194 |
ggagaggctgaatggaagatgatatttg |
221 |
Q |
| |
|
||||||| |||||||||||||||||||| |
|
|
| T |
41866617 |
ggagaggatgaatggaagatgatatttg |
41866644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University