View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_low_118 (Length: 235)
Name: NF15745_low_118
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_low_118 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 15 - 219
Target Start/End: Complemental strand, 26398020 - 26397812
Alignment:
| Q |
15 |
atgaatatgcaagaaccgactttaaaataatttatctattaatc----cataggcatcatagataattaaaatcttattaaataaccttttatttaatgg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26398020 |
atgaatatgcaagaaccgactttaaaataatttatctattaatcaatccataggcatcatagataattaaaatcttattaaataaccttttatttaatgg |
26397921 |
T |
|
| Q |
111 |
cgataaaatcaccaaccaaaagtataaaaccaaaaccttacaatcgaaagagaaagatatcaatttattaagtgtttttctcnnnnnnnagttgaaatat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26397920 |
cgataaaatcaccaaccaaaagtataaaaccaaaaccttacaatcgaaagagaaagatatcaatttattaagtgtttttctctttttttagttgaaatat |
26397821 |
T |
|
| Q |
211 |
attattttt |
219 |
Q |
| |
|
||||||||| |
|
|
| T |
26397820 |
attattttt |
26397812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 62
Target Start/End: Original strand, 25220985 - 25221030
Alignment:
| Q |
17 |
gaatatgcaagaaccgactttaaaataatttatctattaatccata |
62 |
Q |
| |
|
||||||||||||| | ||| ||||||||| |||||||||||||||| |
|
|
| T |
25220985 |
gaatatgcaagaaacaactctaaaataatgtatctattaatccata |
25221030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University