View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_low_119 (Length: 232)
Name: NF15745_low_119
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_low_119 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 15 - 218
Target Start/End: Complemental strand, 45782751 - 45782548
Alignment:
| Q |
15 |
aaagggtaattactcataggaacaagagctaatttataaagaacgcgattagcaacagctaaagaaactgtagtagcggaggttaataaaacagnnnnnn |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45782751 |
aaagggtaattactcataggaacaagagctaatttataaagaacgcgattagcaacagctaaagaaactgtagtagcggaggttaataaaacagtttttt |
45782652 |
T |
 |
| Q |
115 |
nagttgcagtggaccaatcggaagaagaggaagaagatgaagattggaatttgaaaacggttcgatgtttgagattggaagaaggtaaatggaatggtga |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45782651 |
tagttgcagtggaccaatcggaagaagaggaagaagatgaagattggaatttgaaaacggttcgatgtttgagattggaagaaggtaaatggaatggtga |
45782552 |
T |
 |
| Q |
215 |
tttt |
218 |
Q |
| |
|
|||| |
|
|
| T |
45782551 |
tttt |
45782548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University