View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_low_125 (Length: 222)
Name: NF15745_low_125
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_low_125 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 20 - 116
Target Start/End: Original strand, 51901237 - 51901332
Alignment:
| Q |
20 |
tcaccgaaataattttccatcatgcactttgttcaaaaaattagtttaccaaacccctctttaacttacaatgctctcatgaagttaatctgcattc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51901237 |
tcaccgaaataattttccatcatgcactttgttcaaaaaattagtttaccaaacccctc-ttaacttacaatgctcttatgaagttaatctgcattc |
51901332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 138 - 177
Target Start/End: Original strand, 51901393 - 51901432
Alignment:
| Q |
138 |
taagactgaactttttaagatcacaaattttctactaata |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51901393 |
taagactgaactttttaagatcacaaattttctactaata |
51901432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 208
Target Start/End: Original strand, 51901445 - 51901482
Alignment:
| Q |
171 |
actaatagtagaaacgtggcaaccatcatgagtattat |
208 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51901445 |
actactagtagaaacgtggcaaccatcatgagtattat |
51901482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University