View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_low_132 (Length: 215)
Name: NF15745_low_132
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_low_132 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 32259428 - 32259244
Alignment:
| Q |
18 |
ctcttgactaccagcacttccaacaacataacaacccaacaattttgcaaattgtccggccagctgaccgacagcacctgatgccgccgagatgaagacg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32259428 |
ctcttgactaccagcacttccaacaacataacaacccaacaattttgcaaattgtccggccagctgaccgacagcacctgatgccgccgagatgaagaca |
32259329 |
T |
 |
| Q |
118 |
ctttctcctttctttagagaaccaacttcaaagattccggcatatgcagtaataccaggcatgcctattggattagaaagaataa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32259328 |
ctttctcctttctttagagaaccaacttcaaagattccggcatatgcagtaataccaggcatgcctattggattagaaagaataa |
32259244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 104
Target Start/End: Complemental strand, 2431813 - 2431737
Alignment:
| Q |
28 |
ccagcacttccaacaacataacaacccaacaattttgcaaattgtccggccagctgaccgacagcacctgatgccgc |
104 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| || | || ||||| ||||||| |||||||| |
|
|
| T |
2431813 |
ccagcacttccaacaacataacaaccatgcaattttgcaaattggccaacaagttgaccaacagcactggatgccgc |
2431737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 28 - 101
Target Start/End: Complemental strand, 2435203 - 2435130
Alignment:
| Q |
28 |
ccagcacttccaacaacataacaacccaacaattttgcaaattgtccggccagctgaccgacagcacctgatgc |
101 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||| || | || ||||| |||||||| ||||| |
|
|
| T |
2435203 |
ccagcacttccaacaacataacaaccatgcagttttgcaaattgacctacaagttgaccaacagcaccggatgc |
2435130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 74
Target Start/End: Original strand, 2517304 - 2517360
Alignment:
| Q |
18 |
ctcttgactaccagcacttccaacaacataacaacccaacaattttgcaaattgtcc |
74 |
Q |
| |
|
||||| ||| |||||||||||||||||||| ||||| |||||| ||||||||||| |
|
|
| T |
2517304 |
ctctttacttccagcacttccaacaacatagcaaccatgcaatttagcaaattgtcc |
2517360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University