View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_low_136 (Length: 205)
Name: NF15745_low_136
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_low_136 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 114; Significance: 5e-58; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 73 - 190
Target Start/End: Complemental strand, 13270113 - 13269996
Alignment:
| Q |
73 |
tagatcagatcagtaatcatcaaggaaaaaccatggagaatgtgaatgatgaaggtgcaagtccccgtttggttgaacacgttcccaatttggattataa |
172 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13270113 |
tagatcagatcagtaatcttcaaggaaaaaccatggagaatgtgaatgatgaaggtgcaagtccccgtttggttgaacacgttcccaatttggattataa |
13270014 |
T |
|
| Q |
173 |
taattgtgttcaagttga |
190 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
13270013 |
taattgtgttcaagttga |
13269996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 17 - 63
Target Start/End: Complemental strand, 13270184 - 13270138
Alignment:
| Q |
17 |
tgaagtattaagtgaaaaaactaatgttcaggaagatacaagtgaaa |
63 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13270184 |
tgaagtatcaagtgaaaaaactaatgttcaggaagatacaagtgaaa |
13270138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University