View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_low_137 (Length: 204)
Name: NF15745_low_137
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_low_137 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 29041663 - 29041487
Alignment:
| Q |
18 |
aaaacttctgataaataaaagaaataataaataccaacaaatatttggtttaattggtaataatccaactcatatcttataagagccagaa-ccaaattt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
29041663 |
aaaacttctgataaataaaagaaataataaataccaacaaatatttggtttaattggtaataatccaactcatatcttataagagccagaacccaaactt |
29041564 |
T |
 |
| Q |
117 |
tgttgtccatcttattgagtatgtattctataatataatgtaatgtttcttgtttaaaaaaggccacagtataatct |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29041563 |
tgttgtccatcttattgagtatgtattctataatataatgtaatgtttcttgtttaaaaaaggccacaatataatct |
29041487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University