View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_low_34 (Length: 441)
Name: NF15745_low_34
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 397; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 17 - 425
Target Start/End: Original strand, 10223990 - 10224398
Alignment:
| Q |
17 |
aactgctattgagttgcatacacaaatcataactagaggcatcgaactgccattgacattgctcaatcggattctgattatgtttgtttcatgcggttta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10223990 |
aactgctattgagttgcatacacaaatcataactagaggcatcgaactgccattgacattgctcaatcggattctgattatgtttgtttcatgcggttta |
10224089 |
T |
 |
| Q |
117 |
ttggagaatgcacgccgtgtgtttgatgtaatgtctgtgagggattttcattcttgggctaccttgtttgttgcttattatgaaaatggtgagtatgaga |
216 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10224090 |
ttggagaatgcacgccgagtgtttgatgtaatgtctgtgagggattttcattcttgggctaccttgtttgtttcttattatgaaaatggtgagtatgaga |
10224189 |
T |
 |
| Q |
217 |
atgctatagatgtttttgttagtatgttatgtcaattggatgtgatggggttttcttttcctccgtggatttggtcttgtcttctcaaggcttgtgcttg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10224190 |
atgctatagatgtttttgttagtatgttatgtcaattggatgtgatggggttttcttttcctccgtggatttggtcttgtcttctcaaggcttgtgcttg |
10224289 |
T |
 |
| Q |
317 |
tactatgaatgtacctctaggaatgcaagttcatggatgtttattgaagttgggtacttgcgaccatgtgcttattagtagctctttgattagattttac |
416 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10224290 |
tactatgaatgtacctctaggaatgcaagttcatggatgtttattgaagttgggtgcttgcgaccatgtgcttattagtagctctttgattagattttac |
10224389 |
T |
 |
| Q |
417 |
gggaggttc |
425 |
Q |
| |
|
||||||||| |
|
|
| T |
10224390 |
gggaggttc |
10224398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University