View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_low_56 (Length: 355)
Name: NF15745_low_56
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_low_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 8e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 231 - 337
Target Start/End: Original strand, 11112193 - 11112299
Alignment:
| Q |
231 |
tagtaacttctaaaagccaacaagttgagaagcaaaatcaaaataccctagtccataaaatgaaaatttcacgaaggtagtgacaaacctgatattaaat |
330 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11112193 |
tagtaacttctaaaaaccaacaagttgagaagcaaaatcaaaataccctaatccataaaatgaaaatttcacgaaggtagtgacaaacctgatattaaat |
11112292 |
T |
|
| Q |
331 |
aaccttg |
337 |
Q |
| |
|
||||||| |
|
|
| T |
11112293 |
aaccttg |
11112299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University