View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_low_69 (Length: 314)
Name: NF15745_low_69
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_low_69 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 220
Target Start/End: Original strand, 4856258 - 4856465
Alignment:
| Q |
13 |
aaaattgcaatgaaaacttatgcgtaagcgcaatcacaagaaatcgaacaaacagaatcaaaaacgaaaacgcaagactcgcacagattcgaagcaagaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4856258 |
aaaattgcaatgaaaacttatgcgtaagagcaatcacaagaaatcgaacaaacagaatcaaaaacgaaaacgcaagactcgcacagattcgaagcaagaa |
4856357 |
T |
|
| Q |
113 |
ttgaacaagaattgtgaaactgaatcacgaaatgtaattacgcgagaaaatcgaaacacaaaagatgaattgcaataaggaaccctaagatttgggaaaa |
212 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4856358 |
ttgaacgagaattgtgaaactgaatcacgaaatgtaattacgcgagaaaatcgaaacacaaaagatgaattgctataaggaaccctaagatttgggaaaa |
4856457 |
T |
|
| Q |
213 |
aggtgaag |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
4856458 |
aggtgaag |
4856465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University