View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15745_low_78 (Length: 290)
Name: NF15745_low_78
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15745_low_78 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 75 - 283
Target Start/End: Complemental strand, 7177115 - 7176907
Alignment:
| Q |
75 |
gtcagcaacatctccatcatcctaggacaacaaccttacattggtttagcaacaaatgcatgtccacgaaaaggcgattcaaaatcaatccgaggttaca |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7177115 |
gtcagcaacatctccatcatcctaggacaacaaccttatattggtttagcaacaaatgcatgtccacgaaaaggcgattcaaaatcaatccgaggttaca |
7177016 |
T |
 |
| Q |
175 |
catgtaacggcaaaactcaaacatgccaagcatacctcaccttcagaactcaaccaatttactcctcagtttcaacaatatcatcattactaggctcaaa |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7177015 |
catgtaacggcaaaactcaaacatgccaagcatacctcaccttcagaactcaaccaatttactcctcagtttcaacaatatcatcattactaggctcaaa |
7176916 |
T |
 |
| Q |
275 |
ttcatctca |
283 |
Q |
| |
|
| ||||||| |
|
|
| T |
7176915 |
tccatctca |
7176907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University