View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15746_low_4 (Length: 325)
Name: NF15746_low_4
Description: NF15746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15746_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 310
Target Start/End: Original strand, 38024235 - 38024544
Alignment:
| Q |
1 |
cacaactcttccaaccctatgttaaaccacagcgcacaatattttgcaaccattttggtcaatcagatgacaaatgcaatgaggtatctttatgatgcaa |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38024235 |
cacaactcttccaaccctatgataaaccacagcgcacaatattttgcgaccattttggtcaatcagatgacaaatgcaatgaggtatctttatgatgcaa |
38024334 |
T |
 |
| Q |
101 |
aagcaaggaaaatcatatgcttaggagttcttcctttgggatgtacaccccgaatagcgtgggagtcaaatcagacatcagatggtgttatcaatggaaa |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38024335 |
acgcaaggaaaatcatatgcttaggagttcttcctttgggatgtacaccccgaatagcgtgggagtcaaatcagacatcagatggtgttatcaatggaaa |
38024434 |
T |
 |
| Q |
201 |
tggttgtgtagataatgtcaataattgggtcttggaatacaatagattgctggatgagcacatagtccagcttaatgcagaattttctgatgctcatata |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38024435 |
tggttgtgtagataatgtcaataattgggtcttggaatacaatagattgttggatgagcacatagtccagcttaatgcagaattttctgatgctcatata |
38024534 |
T |
 |
| Q |
301 |
gtgttctgtg |
310 |
Q |
| |
|
|||||||||| |
|
|
| T |
38024535 |
gtgttctgtg |
38024544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University