View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15746_low_8 (Length: 232)
Name: NF15746_low_8
Description: NF15746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15746_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 20 - 216
Target Start/End: Complemental strand, 28439594 - 28439400
Alignment:
| Q |
20 |
tgagttaaaagtgtaaattgttttactcttacaattttgaagagaaaaatgctaatttactattaatgtaacattaaaatctgaaaatatnnnnnnnnnn |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
28439594 |
tgagttaaaagtgtaaattgttttactcttacaatttcgaagagaaaaatgctaatttactattaatgtaacaataaaatctgaaagtattctctctctc |
28439495 |
T |
 |
| Q |
120 |
nnnnnnntaacttattcaaaagttggcagtgattcattaaactttacagacaccaaattgcaccacactgctaagatagggtgaaaataggaagatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28439494 |
tctct--taacttattcaaaagttggcagtgattcattaaactttacagacaccaaattgcaccacactgctaagatagagtgaaaataggaagatt |
28439400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University