View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15747_low_5 (Length: 283)
Name: NF15747_low_5
Description: NF15747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15747_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 50 - 266
Target Start/End: Complemental strand, 38327808 - 38327592
Alignment:
| Q |
50 |
cagagaggggtatcgtggacatggtatcccaatggcacgtaactagaaaaaattatttaacattcaataatagtggaaataaattcgatgattgtttata |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38327808 |
cagagaggggtatcgtggacatggtatcccaatggcacgtaactagaaaaaaatatttaacattcaataatagtggaaataaatccgatgattgtttata |
38327709 |
T |
|
| Q |
150 |
acgttctcgaaagttctagattttgaatcgctgaacgtatttttagaatttggcacnnnnnnnttcaaaaagttctagattatcttgtgaaacgatggtt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38327708 |
acgttctcgaaagttctagattttgaatcgctgaacgtatttttagaatttggcactaaaaaattcaaaaagttccagattatcttgtgaaacgatggtt |
38327609 |
T |
|
| Q |
250 |
taatttgtgtagttttt |
266 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38327608 |
taatttgtgtagttttt |
38327592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 135 - 168
Target Start/End: Complemental strand, 38329717 - 38329684
Alignment:
| Q |
135 |
cgatgattgtttataacgttctcgaaagttctag |
168 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
38329717 |
cgatgattgtttataatgttctcgaaagttctag |
38329684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University