View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15747_low_6 (Length: 262)
Name: NF15747_low_6
Description: NF15747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15747_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 248
Target Start/End: Original strand, 40651056 - 40651289
Alignment:
| Q |
20 |
cgaaaacggtagatttgtttttatagggggtgaaaaacaaaattcgttaattttatgaggacgaccttatttctaaaaatgagcaacgatatcttaagga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40651056 |
cgaaaacggtagatttgtttttatagggg-tgaaaaacaaaattggttaattttacgaggacgaccttatttctaaaaatgagcaacgatatcttaagga |
40651154 |
T |
|
| Q |
120 |
ggaaggtagaggaatggggttgttttgacatgttgacacgctc------gaaatagaaataaaataaaagatagtactaattaattttcgacacactgac |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
40651155 |
ggaaggtagaggaatggggttgttttgacatgttgacgcgctcgaaatagaaatagaaataaaataaaagatagtaataattaattttcgacacaccgac |
40651254 |
T |
|
| Q |
214 |
atctcttttcaccgaaatttctcatatctctctct |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40651255 |
atctcttttcaccgaaatttctcatatctctctct |
40651289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 83
Target Start/End: Complemental strand, 40650459 - 40650381
Alignment:
| Q |
5 |
aaaaattaagtagag-cgaaaacggtagatttgtttttatagggggtgaaaaacaaaattcgttaattttatgaggacga |
83 |
Q |
| |
|
||||||||||||| | |||||||| | ||||| |||||||||||| ||||| ||||||||| ||||||||||||||||| |
|
|
| T |
40650459 |
aaaaattaagtagggacgaaaacgatggatttttttttataggggc-gaaaatcaaaattcgctaattttatgaggacga |
40650381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University