View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15747_low_9 (Length: 211)
Name: NF15747_low_9
Description: NF15747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15747_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 81 - 170
Target Start/End: Complemental strand, 872382 - 872294
Alignment:
| Q |
81 |
acctctagcctcaatgttagataaaatgctaaataannnnnnngtcaatttaaatttttacccaacactttttcctatcccccataaatc |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||||||| |||||||||||||||| || ||||||||| |
|
|
| T |
872382 |
acctctagcctcaatgttagataaaatgctaaataattttttttttaatttaaattttta-ccaacactttttcctaccctccataaatc |
872294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University