View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15748_low_10 (Length: 390)
Name: NF15748_low_10
Description: NF15748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15748_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 1e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 19 - 244
Target Start/End: Complemental strand, 21488025 - 21487804
Alignment:
| Q |
19 |
atgtacgttctaaactaaacctctaacctatcaatagatgataaaaccctagcttggcttcacacactttaactcgtaaacatcctaacaatcttttgaa |
118 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21488025 |
atgtacgttctaaaccaaacctctaacctatcaa---atgataaaaccctagcttggcttcactcactttaacttgtaaacatcctaacaatcttttgaa |
21487929 |
T |
|
| Q |
119 |
aatcaggtccacattgcccaattggacatcnnnnnnnctttgtcaagaaaattggatgccatttgttgtttctagttcaattatggtttatctacaaatt |
218 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21487928 |
aatcaggtc-acattgcccaattggacatctttttttctttgtcaagaaaattggatgccatttgttgtttctagttcaattatggtttatctacaaatt |
21487830 |
T |
|
| Q |
219 |
gcatatattgagcaaaatatgagaga |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
21487829 |
gcatatattgagcaaaatatgagaga |
21487804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University