View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15749_high_1 (Length: 302)
Name: NF15749_high_1
Description: NF15749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15749_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 18 - 164
Target Start/End: Complemental strand, 41263168 - 41263020
Alignment:
| Q |
18 |
gttccttcacctccataagcactacaacaacattgtggtgtcgttgcaaatatgatctggcaaacctgcataaaagg--ggggaaatgcaattttagaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41263168 |
gttccttcacctccataagcactacaacaacattgtggtgtcgttgcaaatatgatctggcaaacctgcataaaaggggggggaaatgcaattttagaat |
41263069 |
T |
 |
| Q |
116 |
ttctcctttgtctctatcattcagcaacatgttaattgtatcccatttc |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41263068 |
ttctcctttgtctctatcattcagcaacatgttaattgtatcccatttc |
41263020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 248 - 286
Target Start/End: Complemental strand, 41263023 - 41262985
Alignment:
| Q |
248 |
tttctgttaaacccagccatagatctctccacacctaac |
286 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
41263023 |
tttctgttaaacgcaaccatagatctctccacacctaac |
41262985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University