View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1574_high_16 (Length: 272)
Name: NF1574_high_16
Description: NF1574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1574_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 13 - 254
Target Start/End: Complemental strand, 17216373 - 17216132
Alignment:
| Q |
13 |
aaaatagatggctaggattgaactcagccatggtctaatatcatgttgagtaccaactctgataaaagcatacaaaatagacatcatgcttgaattcttt |
112 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17216373 |
aaaatagatggttaggattgaactcagccatggtctaatatcatgttgaataccaactctgataaaagcgtacaaaatagacatcatgcttgaattcttt |
17216274 |
T |
|
| Q |
113 |
tggaagtttagtgttaacatgtttaaaaataacatattcacaactattattttgtctcttgttcaatagatgaatatccaaattagtctctgtgttgatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17216273 |
tggaagtttagtgttaacatgtttaaaaataacatattcacaactattattttgtctcatgttcaatagatgaatatccaaattagtctctgtgttgatt |
17216174 |
T |
|
| Q |
213 |
tatttatgtcatatctgttgtagctccttctgtaaataaagc |
254 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17216173 |
tatttatgttatatctgttgtagctccttctgtaaataaagc |
17216132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University