View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1574_high_18 (Length: 251)
Name: NF1574_high_18
Description: NF1574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1574_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 10 - 233
Target Start/End: Original strand, 47210555 - 47210777
Alignment:
| Q |
10 |
agtagcaaaggatagatgcctgccaactcctatgggttgtctttgcattcttttttatcatcgtcgttgcttttggcatgcttctatttgcagtttacga |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47210555 |
agtaccaaaggatagatgcctgccaactcctatgggttgtctttgcattctttt-tatcatcgtcgttgcttttggcatgcttctatttgcagtttacga |
47210653 |
T |
|
| Q |
110 |
caacagttcacatcctaagcttccatattttggagtggaatcagcttctctcaactcacttagtatgaatggttctagactcagtggtgaatggaacatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47210654 |
caacagttcacatcctaagcttccatattttggagtggaatcagcttctctcaactcacttactatgaatggttctagactcagtggtgaatggaacatt |
47210753 |
T |
|
| Q |
210 |
aacctcacctttacaaaccctaac |
233 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
47210754 |
aacctcacctttacaaaccctaac |
47210777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University