View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1574_low_17 (Length: 282)
Name: NF1574_low_17
Description: NF1574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1574_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 19 - 266
Target Start/End: Complemental strand, 27837203 - 27836956
Alignment:
| Q |
19 |
cataatacttctctcttaactattgataaatggattcgtagttgatattatatgcacatgcataacaaatcgttagtataatgaaacattatttatattt |
118 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27837203 |
cataacacttctctcttaactattgataaatggattcgtagttgatattatatgcacatgcataacaaatcgttagtataatgaaacattatttatattt |
27837104 |
T |
|
| Q |
119 |
ggttttttcactttactcgatttactttagaggaggcaaatcaaaattttcctnnnnnnnntaaattaacaatgtaaatgacttatttgctttaaggcaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
27837103 |
ggttttttcactttactcgatttactttagaggaggcaaatcaaaattttcctaaaaaaaataaattaacagtgtaaatgacttatttgctttaaggtaa |
27837004 |
T |
|
| Q |
219 |
ataatatagtaaattttgcaagttgcatatggtattggtatatggtat |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27837003 |
ataatatagtaaattttgcaagttgcatatggtattggtatatggtat |
27836956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 57 - 91
Target Start/End: Complemental strand, 35257365 - 35257331
Alignment:
| Q |
57 |
tagttgatattatatgcacatgcataacaaatcgt |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35257365 |
tagttgatattatatgcacatgcataacaaatcgt |
35257331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 59 - 88
Target Start/End: Complemental strand, 42731683 - 42731654
Alignment:
| Q |
59 |
gttgatattatatgcacatgcataacaaat |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42731683 |
gttgatattatatgcacatgcataacaaat |
42731654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 59 - 89
Target Start/End: Complemental strand, 1550480 - 1550450
Alignment:
| Q |
59 |
gttgatattatatgcacatgcataacaaatc |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1550480 |
gttgatattatatgcacatgcataacaaatc |
1550450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 91
Target Start/End: Original strand, 15252198 - 15252232
Alignment:
| Q |
57 |
tagttgatattatatgcacatgcataacaaatcgt |
91 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
15252198 |
tagttgatattatatggacatgcataacaaatcgt |
15252232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University