View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1574_low_18 (Length: 273)
Name: NF1574_low_18
Description: NF1574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1574_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 18 - 261
Target Start/End: Original strand, 7791340 - 7791576
Alignment:
| Q |
18 |
ataaaagataatagtttgtatttatccgagtgatcatagtttaattgacaaatatattacatataacatgtggaagtctgatatggactttaaacatctc |
117 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7791340 |
ataaaaaataataatttgtatttatccgagtgatcatagtttaatcaacaaatatattacatataacat---gaagtctgatatggactttaaacatctc |
7791436 |
T |
 |
| Q |
118 |
a---cttattcatcttatgatatgaatgaaaatctaaccatcacactattttgatnnnnnnnnnntagtgttgtatttattaaaaatattctaaaccaag |
214 |
Q |
| |
|
| |||||||||||||||||||||| ||||||||||||||||| |||||| ||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
7791437 |
atttattattcatcttatgatatgaat----atctaaccatcacacta-tttgat--aaaaaaaatagtgttgtatttgttaaaaatattttaaaccaag |
7791529 |
T |
 |
| Q |
215 |
ttttattcaagttttcgtcataaaagctttattaaattattttgttc |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7791530 |
ttttattcaagttttcgtcataaaagctttattaaattattttgttc |
7791576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University