View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1574_low_25 (Length: 236)

Name: NF1574_low_25
Description: NF1574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1574_low_25
NF1574_low_25
[»] chr1 (1 HSPs)
chr1 (1-220)||(16509486-16509705)


Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 16509486 - 16509705
Alignment:
1 gacggtggtggagtgtaagacggaatctgatgaaccacgttcgatgcttgcgttcgatgattttttgaaagctacgaacacgaaagttgcttctgttgat 100  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16509486 gacggtggtggagtgtaagacggaatctgatgaacgacgttcgatgcttgcgttcgatgattttttgaaagctacgaacacgaaagttgcttctgttgat 16509585  T
101 gaatcgatgaaatcaatggaggctgaatcaacggttcaaacgaaggtagaaagttctgatgttgatgtggttttcgagacgcaagaatcggtgaaatcat 200  Q
    |||||| ||||||||||||| |||||||||||| |||||| ||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||     
16509586 gaatcgttgaaatcaatggaagctgaatcaacgattcaaatgaaggtagaaagttctgatgttgatgtagtttttgagacgcaagaatcggtgaaatcaa 16509685  T
201 tggatgaagttcctaatctc 220  Q
    |||| |||||||||||||||    
16509686 tggaagaagttcctaatctc 16509705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University