View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1574_low_25 (Length: 236)
Name: NF1574_low_25
Description: NF1574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1574_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 16509486 - 16509705
Alignment:
| Q |
1 |
gacggtggtggagtgtaagacggaatctgatgaaccacgttcgatgcttgcgttcgatgattttttgaaagctacgaacacgaaagttgcttctgttgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16509486 |
gacggtggtggagtgtaagacggaatctgatgaacgacgttcgatgcttgcgttcgatgattttttgaaagctacgaacacgaaagttgcttctgttgat |
16509585 |
T |
 |
| Q |
101 |
gaatcgatgaaatcaatggaggctgaatcaacggttcaaacgaaggtagaaagttctgatgttgatgtggttttcgagacgcaagaatcggtgaaatcat |
200 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||| |||||| ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
16509586 |
gaatcgttgaaatcaatggaagctgaatcaacgattcaaatgaaggtagaaagttctgatgttgatgtagtttttgagacgcaagaatcggtgaaatcaa |
16509685 |
T |
 |
| Q |
201 |
tggatgaagttcctaatctc |
220 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
16509686 |
tggaagaagttcctaatctc |
16509705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University