View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1575-INSERTION-3 (Length: 234)
Name: NF1575-INSERTION-3
Description: NF1575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1575-INSERTION-3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 15 - 188
Target Start/End: Complemental strand, 19872427 - 19872251
Alignment:
| Q |
15 |
ggttctcttactttttgaatgatatggcgtgctgatcagt-acatggattctacataatagtatctacatggtccatcattttcacctcatcaattacga |
113 |
Q |
| |
|
|||||||||||||||||||||||||| | |||| |||| | |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19872427 |
ggttctcttactttttgaatgatatgacttgctcatcaatgacatgggttctacataatagtatctacatggtccatcattttcacctcatcaattacga |
19872328 |
T |
|
| Q |
114 |
ttttaagaaaacataaaaataaaatatcaatattattcaagaacccta--accaataattcccaaattgattgtcaa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
19872327 |
ttttaagaaaacataaaaataaaatatcaatattattcaagaaccctaataccaataattcccatattgattgtcaa |
19872251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 206 - 234
Target Start/End: Complemental strand, 19872233 - 19872205
Alignment:
| Q |
206 |
agagatacatagattttccgcttcaatca |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19872233 |
agagatacatagattttccgcttcaatca |
19872205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University