View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1575-INSERTION-7 (Length: 451)
Name: NF1575-INSERTION-7
Description: NF1575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1575-INSERTION-7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 8 - 240
Target Start/End: Original strand, 42519022 - 42519254
Alignment:
| Q |
8 |
atgatggaaatgattctgattcttccaattactcaaatgaaaatccaccacagaggaaacaaagttcttataatccatcatggcctcagagttacaggtt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42519022 |
atgatggaaatgattctgattcttccaattactcaaatgaaaatccaccacagaggaaacaaagttcttataatccatcatggcctcagagttacaggtt |
42519121 |
T |
|
| Q |
108 |
aagtccttttttcaatccccctagatttcagtgcacctgtgtgtgtcacttcacgtacctttttgtttgtttctgtttctgcaaatgtaaagggaatcct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42519122 |
aagtccttttttcaatccccctagatttcagtgcacctgtgtgtgtcacttcacgtacctttttgtttgtttctgtttctgcaaatgtaaagggaatcct |
42519221 |
T |
|
| Q |
208 |
tggaatttctggaaataatggttttaattgtca |
240 |
Q |
| |
|
|| ||||||||||| ||||||||||| |||||| |
|
|
| T |
42519222 |
tgtaatttctggaattaatggttttacttgtca |
42519254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 163; E-Value: 7e-87
Query Start/End: Original strand, 269 - 451
Target Start/End: Original strand, 42519283 - 42519465
Alignment:
| Q |
269 |
gatataatccttgtaaagtagttttactttttctggtggatgtgattcatctgaaattcctttatgaactttattcattagtttctgctaataaagagaa |
368 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42519283 |
gatataatccttgtaaagtagttttaatttttctggtggatgtgattcatctgaaattcctttatgaactttattcattagtttctgctaataaagagaa |
42519382 |
T |
|
| Q |
369 |
tagaatatatctcttttctggtcttaaaccccgattatatggaacgagggtcctggtaatctgaagctcgaccaagagatgag |
451 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| | |||||||||||| |
|
|
| T |
42519383 |
tagaatatatctcttttctggtcttaaaccccgattgtatggaacgagggtccaggtaatctgaagcttggccaagagatgag |
42519465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University