View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1575-INSERTION-8 (Length: 253)
Name: NF1575-INSERTION-8
Description: NF1575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1575-INSERTION-8 |
 | |
|
| [»] scaffold0191 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0191 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: scaffold0191
Description:
Target: scaffold0191; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 7 - 167
Target Start/End: Original strand, 22114 - 22274
Alignment:
| Q |
7 |
atcaatagcgtgtattattctcttaaaatgttgatggaaaatgtttcaaatctcaactcgctaatttggttgtattatccttattttagcatttgaatga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22114 |
atcaatagcgtgtattattctcttaaaatgttgatggaaaatgtttcaaatcccaactcgctaatttggttgtattatccttattttagcatttgaatga |
22213 |
T |
|
| Q |
107 |
aatttagtttactataataaaatnnnnnnnntatctatggtcgttaatacattgacatgag |
167 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22214 |
aatttaatttactataataaaataaaaaaaatatctatggtcgttaatacattgacatgag |
22274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University