View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15750_high_2 (Length: 374)
Name: NF15750_high_2
Description: NF15750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15750_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 5e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 1331421 - 1331175
Alignment:
| Q |
1 |
aattgcatcaacattaacgtcattagtaccatcatgagtcgcgtcatttgcatcaacaatgtcgtcatcatcaacaaaattttcaacatgagtaataaca |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1331421 |
aattgcatcaacattaacgtcatcagtaccatcatgagtcgcgtcatttgcatcaacaatgtcgtcattatcaacaaaattttcaacatgagtaataaca |
1331322 |
T |
 |
| Q |
101 |
agtgttgcacccgcgcttcaaaagccttggaggatgctatgccgtatgtattctccttgtcaacatatttatgaattgttttctttgaaacatatgc-gg |
199 |
Q |
| |
|
|||| || ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
1331321 |
agtg--------gcacttcaaaagccttggaggatgctatgccgtatgcattctccttgtcaacatatttatgaattgttttcttcgaaacatatgcagg |
1331230 |
T |
 |
| Q |
200 |
gnnnnnnnnaccacgatctacattttccacaaccttccgagggattaaccaacga |
254 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
1331229 |
tttttttttaccatgatctacattttccacaatcttccgagggatcaaccaacga |
1331175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University