View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15751_low_1 (Length: 355)
Name: NF15751_low_1
Description: NF15751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15751_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 11 - 339
Target Start/End: Complemental strand, 36449447 - 36449119
Alignment:
| Q |
11 |
catcatcaactgatccggtggtggtttcctccgcgaagaacccgaatcaaattagacgcatttctcctaactttctcactatcatcctctaccatcccaa |
110 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36449447 |
catcatcaactgatcctgtggtggtttcctccgcgaagaacccgaatcaaattagacgcatttctcctaactttctcactattatcctctaccatcccaa |
36449348 |
T |
 |
| Q |
111 |
tacaaatttccaaaaccccttcttgcagagtcatcataagtatttccttgctatgcaaacaaacaaaagtaagtgccaacaatgcatattgaatccctct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36449347 |
tacaaatttccaaaaccccttcttgcagagtcatcataagtatttccttgctatgcaaacaaaccaaagtaagtgccaacaatgcatattgaatccctct |
36449248 |
T |
 |
| Q |
211 |
tgaacttccattcctcaaaacactcaccaaaatcttcgcacaaccaccataactctccaattgctccctcccttccttgcatttcgccaaaacaccaatc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36449247 |
tgaacttccattcctcaaaacactcaccaaaatcttcgcacaaccaccataactctccaattgctccctcccttccttgcatttcgccaaaacaccaatc |
36449148 |
T |
 |
| Q |
311 |
acctcaacacccccctcaagtccactttc |
339 |
Q |
| |
|
||||||||||||| ||||||||||||||| |
|
|
| T |
36449147 |
acctcaacacccctctcaagtccactttc |
36449119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University