View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15751_low_2 (Length: 219)
Name: NF15751_low_2
Description: NF15751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15751_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 13 - 205
Target Start/End: Complemental strand, 5828940 - 5828748
Alignment:
| Q |
13 |
ttgatgatgtgtttgtgaaaagtctttattgacgatgtatttgaattttttggttgctcctctttattagttcctctctctattagacggttggttcttc |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5828940 |
ttgataatgtgtttgtgaaaagtctttattgatgatgtatttgaatttttttgttgctcctctttattagttcctctctctattagacagttggttcttc |
5828841 |
T |
|
| Q |
113 |
tctttggttattgtgtcttcttttattgttcttctctctatcggggaaaccgcatagtaaaatttctacaaagtggaagtgtaaccactagtg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5828840 |
tctttggttattgtgtcttcttttattgttcttctctctatcggggaaaccgcataataaaatttctacaaagtggaagcgtaaccactagtg |
5828748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University