View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15751_low_3 (Length: 217)
Name: NF15751_low_3
Description: NF15751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15751_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 6 - 121
Target Start/End: Original strand, 44623652 - 44623767
Alignment:
| Q |
6 |
gatgtcgaagaatattctatcggagtggaagtgtctgaggatgcggttccggttgcggtggaagagaaacccgtgaaaaagaaaggtaagaaaggtaatg |
105 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44623652 |
gatgacgatgaatattctatcggagtggaagtgtctgaggatgcgattccggttgcggtggaagagaaacccgtgaaaaagaaaggtaagaaaggtaatg |
44623751 |
T |
|
| Q |
106 |
ctaaatcgaaaaaaga |
121 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44623752 |
ctaaatcgaaaaaaga |
44623767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University