View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15752_high_10 (Length: 237)

Name: NF15752_high_10
Description: NF15752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15752_high_10
NF15752_high_10
[»] chr8 (1 HSPs)
chr8 (73-221)||(44927308-44927457)


Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 73 - 221
Target Start/End: Complemental strand, 44927457 - 44927308
Alignment:
73 gcaggattaatattgccacatatggattgggtattattgaatctaaaccttgacagtgactgaatcacctgt-gctctgaactaccagctcatattaata 171  Q
    |||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||    
44927457 gcagtattgatattgccacatatggattgggtattattgaatctaaaccttgacagtgaccgaatcacctgttgctctgaactaccagctcatattaata 44927358  T
172 acatagagatagaggcataataatattgaattttgcgacgtgcatttagt 221  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||    
44927357 acatagagatagaggcataataatattgaattttgcaacgtgcatttagt 44927308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University