View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15752_high_7 (Length: 243)
Name: NF15752_high_7
Description: NF15752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15752_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 13 - 226
Target Start/End: Original strand, 1830367 - 1830595
Alignment:
| Q |
13 |
aagaatatttagcttttggtgcactaatataataattttggtccatatattaggttcattaatataccaatgagagtatttaaatagaatacacataact |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1830367 |
aagaatatttagcttttggtgcactaatataataattttggtccatatattaggttcattaatataccaatgagagtatttaaatagaatacacataact |
1830466 |
T |
|
| Q |
113 |
gttgcattatgtgttgattctatgatacgcataatcttatggctaggtagttaggcctc---------------tgtcttcaactagatcagtgtctcct |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1830467 |
gttgcattatgtgttgattctatgatacgcataatcttatggctaggtagttaggcctctgtttgcatgggtcgtgtcttcaactagatcagtgtctcct |
1830566 |
T |
|
| Q |
198 |
ccattacaactccaccccaactttgctct |
226 |
Q |
| |
|
||||||||||||||||||| ||||||||| |
|
|
| T |
1830567 |
ccattacaactccaccccacctttgctct |
1830595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 58 - 170
Target Start/End: Original strand, 1814787 - 1814899
Alignment:
| Q |
58 |
tatattaggttcattaatataccaatgagagtatttaaatagaatacacataactgttgcattatgtgttgattctatgatacgcataatcttatggcta |
157 |
Q |
| |
|
|||||| ||||||| |||| ||| ||||||||||| |||||||||| | | ||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
1814787 |
tatatttggttcatcaatagaccgatgagagtattcaaatagaatatatagaactgttgcattatgtgttgattctatgatattcataatcttatagcta |
1814886 |
T |
|
| Q |
158 |
ggtagttaggcct |
170 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1814887 |
ggtagttaggcct |
1814899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University