View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15752_low_9 (Length: 240)
Name: NF15752_low_9
Description: NF15752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15752_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 2 - 239
Target Start/End: Complemental strand, 8657116 - 8656879
Alignment:
| Q |
2 |
atgaacgggttagagtttagagagtataatatttcatagtagaaaaaagggatatatgagattggtgccggtgttttcgctagtaaggttattatgatga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8657116 |
atgaacgggttagagtttagagagtataatatttcatagtagaaaaaagggatatatgagattggtgccggtgttttcgctagtaaggttattatgatga |
8657017 |
T |
|
| Q |
102 |
agcatatgtcatgtgtaattgttattgacgtgtattaattttactgcaagatatgcagttttctttaaatatacataatataattgggtttattttacaa |
201 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8657016 |
agcatatgtcatgcgtaattgttattgacgtgtattaattttactgcaagacatgcagttttctttgaatatacataatataattgggtttattttacaa |
8656917 |
T |
|
| Q |
202 |
agtnnnnnnngaaaggaaggtgaaaaatctcaaacatt |
239 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |
|
|
| T |
8656916 |
agtaaaaaacgaaaggaaggtgaaaaatctcaaacatt |
8656879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University