View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15753_high_11 (Length: 271)
Name: NF15753_high_11
Description: NF15753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15753_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 16 - 267
Target Start/End: Original strand, 2374776 - 2375028
Alignment:
| Q |
16 |
ataataagaaaagttattgcagaatctttaatagttccaactgggtgtaattgtcttgattagaaagggagatatagcgaaatgaaggtcgaacaatgtc |
115 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
2374776 |
ataataagtaaagttattgcagaatctttaatagttccaactgggtgtaattgtcttgattagaaaggaagatatagcgaaatgaaggtcaaacaatgtc |
2374875 |
T |
|
| Q |
116 |
aaagtcacctaatgcgatatatttctctttaatttcataaac-aaaattattgttgtagacatgtcatcccaacattttacactttaatttcataaacaa |
214 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2374876 |
aaagtcacataatgtgatatatttctctttaatttcataaacaaaaattattgttgtagacatgtcatcccaacattttacactttaatttcataaacaa |
2374975 |
T |
|
| Q |
215 |
aattactaccatatttctgcattagaatatagaagacctaaccaacctttgct |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
2374976 |
aattactaccatatttctgcattagaatatagaagacataaccaacttttgct |
2375028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University