View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15753_high_9 (Length: 326)
Name: NF15753_high_9
Description: NF15753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15753_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 11 - 294
Target Start/End: Original strand, 51729517 - 51729800
Alignment:
| Q |
11 |
cacagacctttcggataaaatatgctagacaggatgttcatttatgtatgatgatctcgttcgacttatcacgtagtagatctatggtaatgatctctct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51729517 |
cacagacctttcggataaaatatgctagacaggatgttcatttatgtatgatgatctcgttcgacttatcacgtagtagatctatggtaatgatctctct |
51729616 |
T |
 |
| Q |
111 |
atcactttcttctctttctatgtccattaaggggaaggaaacgtagtgagaatcaaattatatcttcatgccattgtgctaattatctatctagtaaggt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51729617 |
gtcactttcttctctttctatgtccattaaggggaaggaaacgtagtgagaatcaaattatatcttcatgccattgtgctaattatctatctagtaaggt |
51729716 |
T |
 |
| Q |
211 |
cccatatataccgcacgtcaacaaggttggcatacctattgcttataaatttgtctatacatgccagcacagctgcactaccgc |
294 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51729717 |
cccgtatataccgcacgtcaacaaggttggcatacctattgcttataaatttgtctatacatgccagcacagctgcactaccgc |
51729800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 351423 - 351475
Alignment:
| Q |
19 |
tttcggataaaatatgctagacaggatgttcatttatgtatgatgatctcgtt |
71 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||| ||||||| |
|
|
| T |
351423 |
tttcggataaaatatgctcggcaggatgttcatttatgtatgatggtctcgtt |
351475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University