View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15753_low_17 (Length: 241)
Name: NF15753_low_17
Description: NF15753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15753_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 19 - 230
Target Start/End: Original strand, 55714607 - 55714818
Alignment:
| Q |
19 |
attgccatgatccacattcacagatttttgcgcactccgatcactgctactataattcaacaatattttaatattttaaagattnnnnnnnnttacgaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
55714607 |
attgccatgatccacattcacagatttttgcgcactccgatcactgctactataattcaacaatattttaatattttaaagattaaaaaaaattacgaaa |
55714706 |
T |
|
| Q |
119 |
cacagacactcttcaaattagacgtgtcccaatgtcgaacattgacatatataatacaatgaattatgtcatttttaaaaattattgtcgatgtacatgt |
218 |
Q |
| |
|
|| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
55714707 |
catggacactcttcaaattagacgtgtctcaatgtcgaacattgacatatataatacagtgaattatgtcatttttaaaaattattgtcgatgtacgtga |
55714806 |
T |
|
| Q |
219 |
catacttcatat |
230 |
Q |
| |
|
|||||||||||| |
|
|
| T |
55714807 |
catacttcatat |
55714818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University