View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15753_low_19 (Length: 223)
Name: NF15753_low_19
Description: NF15753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15753_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 12 - 206
Target Start/End: Complemental strand, 46537650 - 46537456
Alignment:
| Q |
12 |
gataatactcaaggcgtatgattaaaccggggtgaaccggcatgcgaaccggttgacacgggttacacgaactacacttggatctacacgacggaggtgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46537650 |
gataatactcaaggcgtatgattaaaccggggtgaaccggcatgcgaaccggttgacacgggttacacgaactacacttggatctacacgacggaggtgt |
46537551 |
T |
 |
| Q |
112 |
tgaccctggcccagcaagcttcttctgctccaccacctctctcttcttccacggtgatgtcggagacccgttttccattttttgatgcttcagta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46537550 |
tgaccctggcccagcaagcttcttctgctccaccacctctctcttcttccacggtgatgtcggagacccgttttccattttttgatgcttcagta |
46537456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University