View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15754_low_1 (Length: 358)
Name: NF15754_low_1
Description: NF15754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15754_low_1 |
 | |
|
| [»] scaffold0072 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0072 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 47 - 345
Target Start/End: Original strand, 41674 - 41972
Alignment:
| Q |
47 |
gttaaaaacatcactagatctgagatgatgctgagaagagaaaaaggattatgttattattgtgatgaacgattctctatatctcataaatgtccaaatc |
146 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41674 |
gttaaaaacatcactagagctgagatgatgctcagaagagaaaaaggattatgctattattgtgatgaacgattctctatatctcataaatgtccaaatc |
41773 |
T |
|
| Q |
147 |
gtcattatttcttatttcaaactgaagaagaagaagaacctgacccaccaccaccgcaaatcacaccatcaactgaccctgaaacaccacctattgttac |
246 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41774 |
gtcattatttcttattccaaactgaagaagaagaagaacctgaaccaccaccacaacaaatcacaccatcagctgaccctgaaacaccacctattgttac |
41873 |
T |
|
| Q |
247 |
ggaggagcaccacttgtcactgaatgccttgaacggttctgctcgtaaaggcaccatgcggttccacggtcaaattcagggtattgctatcacgatttt |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41874 |
ggaggagcaccacttgtcactgaatgccttgaacggttctgctcgtaaaggcaccatgcggttccacagtcaaattcagggtattgctatcacgatttt |
41972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 80 - 141
Target Start/End: Original strand, 8596019 - 8596080
Alignment:
| Q |
80 |
agaagagaaaaaggattatgttattattgtgatgaacgattctctatatctcataaatgtcc |
141 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||| |||||| | |||||||||||||| |
|
|
| T |
8596019 |
agaagagaaaaaggtttatgttatttttgtgatgagaaattctcattttctcataaatgtcc |
8596080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University