View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15754_low_7 (Length: 207)
Name: NF15754_low_7
Description: NF15754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15754_low_7 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 94 - 207
Target Start/End: Original strand, 47116985 - 47117094
Alignment:
| Q |
94 |
caatatcaacgtatcaatgactcgatcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcggagaatgtatgataggcaaca |
193 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116985 |
caatatcaacgtatcaatgactcga----tcaccttttaacgattatttttaatttcttgttttgtagatggataggcggagaatgtatgataggcaaca |
47117080 |
T |
|
| Q |
194 |
aagctcaacgggaa |
207 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
47117081 |
aagctcaacgggaa |
47117094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University