View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15756_high_17 (Length: 249)
Name: NF15756_high_17
Description: NF15756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15756_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 37156123 - 37156343
Alignment:
| Q |
17 |
cttcttgaatttggaatttctttttaaacataacctaactaggaaattttaatttgtctagaaaataataacatattttaaattgaaataaaaaattgtg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
37156123 |
cttcttgaatttggaatttctttttaaacataacctaactaggaaattttaatttgtctagaaaataataacatattttatattgaaataacaaattgtg |
37156222 |
T |
 |
| Q |
117 |
ttcaagtgcttaataaactttagcctcggtggtgtctaacactcacacgacatcgacatttgtaattatattaaaatatgnnnnnnnnncaaaatttcat |
216 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||| |||||||||| ||||||||||||| | |||||| | ||||||||||| |
|
|
| T |
37156223 |
ttcaagtgcttaataaactttaacttcggtggtgtctaacatcgacacgacatccacatttgtaattacaataaaatgt-tttttttttcaaaatttcat |
37156321 |
T |
 |
| Q |
217 |
caatgtttacgtgttcgtgtct |
238 |
Q |
| |
|
||||||||||||||| |||||| |
|
|
| T |
37156322 |
caatgtttacgtgttggtgtct |
37156343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University